Cinvestav  Blast to the Chili Database  Computational Biology Lab


In this page you will be able to blast a nucleotide sequence to the contigs present in the database.
You must input the only the sequence, i.e., the ATGC characters in the box provided.
Do not include any other characters.


Mantainer:   Octavio Martínez


(end of BLAST report above)
Example of a valid sequence to input in the box:

GTAATGTCCTATTGCAGATGTCCGAGCTGAATTGCTCATGT

attgccgtactcgat
ATGCCAGACAGCAAGTTAATACAGCTGCAAAAA
TCAAATGTGAGTGGCCAAAAAAAACCAGCTCTTGGTTGCTTGTGTTCA
AGCAGATCAAGATATTTAAAGCCATACATAGAACTTCAAGTCTTATGAGTAACATTAACTCCATTATTCCCC

TTTCCTCTGACAAGTAACAGAAAAATAAATCAAGTTGATTGAGGGAATGAACTTGGGAAAACAG


(i.e., spaces, distinct rows, lower or upper cases of ATGCatgc are allowed)

Input your sequence (remember: only DNA characters [ATGC]):



If the box is not empty, substitute the content by your sequence.

Go back to the main page